Transcript: Mouse XM_006519510.3

PREDICTED: Mus musculus transmembrane and tetratricopeptide repeat containing 4 (Tmtc4), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmtc4 (70551)
Length:
3712
CDS:
463..2688

Additional Resources:

NCBI RefSeq record:
XM_006519510.3
NBCI Gene record:
Tmtc4 (70551)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519510.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000198290 GCTAAGTTAGTAGTGGGATTT pLKO.1 523 CDS 100% 10.800 15.120 N Tmtc4 n/a
2 TRCN0000151358 GCTAAGGTTCACTACAACATT pLKO.1 1906 CDS 100% 5.625 7.875 N TMTC4 n/a
3 TRCN0000216948 CGTGGAACAACATGATCATAC pLKO.1 2321 CDS 100% 10.800 7.560 N Tmtc4 n/a
4 TRCN0000151438 GCTTTATTCCTCAAGGCAATT pLKO.1 2479 CDS 100% 10.800 7.560 N TMTC4 n/a
5 TRCN0000178142 GCAACAGTGTAACTTGAAGTT pLKO.1 3137 3UTR 100% 4.950 3.465 N Tmtc4 n/a
6 TRCN0000293092 GCAACAGTGTAACTTGAAGTT pLKO_005 3137 3UTR 100% 4.950 3.465 N Tmtc4 n/a
7 TRCN0000198394 GCAGGATAATATTCCACTGTT pLKO.1 3327 3UTR 100% 4.950 3.465 N Tmtc4 n/a
8 TRCN0000198966 GCGATTAAACACAGGAGGAAA pLKO.1 2188 CDS 100% 4.950 3.465 N Tmtc4 n/a
9 TRCN0000177772 CCTTATGTTCTCATTGGCAAA pLKO.1 2421 CDS 100% 4.050 2.835 N Tmtc4 n/a
10 TRCN0000293093 CCTTATGTTCTCATTGGCAAA pLKO_005 2421 CDS 100% 4.050 2.835 N Tmtc4 n/a
11 TRCN0000182467 GCCATGAATAACCTCGGGAAT pLKO.1 2014 CDS 100% 4.050 2.835 N Tmtc4 n/a
12 TRCN0000293094 GCCATGAATAACCTCGGGAAT pLKO_005 2014 CDS 100% 4.050 2.835 N Tmtc4 n/a
13 TRCN0000178703 CCTGACTTTCAGGATTAACTA pLKO.1 726 CDS 100% 5.625 3.375 N Tmtc4 n/a
14 TRCN0000293095 CCTGACTTTCAGGATTAACTA pLKO_005 726 CDS 100% 5.625 3.375 N Tmtc4 n/a
15 TRCN0000151284 CTGAGAAGAAAGCTAGAACTA pLKO.1 2647 CDS 100% 4.950 3.465 N TMTC4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519510.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14318 pDONR223 100% 45.6% 44.8% None (many diffs) n/a
2 ccsbBroad304_14318 pLX_304 0% 45.6% 44.8% V5 (many diffs) n/a
3 TRCN0000478510 TTTTGAGCACGAAAAGTAATTTTG pLX_317 25.8% 45.6% 44.8% V5 (many diffs) n/a
Download CSV