Transcript: Mouse XM_006519579.3

PREDICTED: Mus musculus Rho guanine nucleotide exchange factor (GEF) 3 (Arhgef3), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Arhgef3 (71704)
Length:
3736
CDS:
144..1799

Additional Resources:

NCBI RefSeq record:
XM_006519579.3
NBCI Gene record:
Arhgef3 (71704)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519579.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110049 GCTGTTTAGAATCACCCTTCA pLKO.1 940 CDS 100% 4.050 5.670 N Arhgef3 n/a
2 TRCN0000351733 GCTGTTTAGAATCACCCTTCA pLKO_005 940 CDS 100% 4.050 5.670 N Arhgef3 n/a
3 TRCN0000110045 CCAGTTTCATTAGCTCTCATT pLKO.1 2980 3UTR 100% 4.950 3.465 N Arhgef3 n/a
4 TRCN0000351735 CCAGTTTCATTAGCTCTCATT pLKO_005 2980 3UTR 100% 4.950 3.465 N Arhgef3 n/a
5 TRCN0000110048 GCGATCTTTGAACTTTCTCAA pLKO.1 597 CDS 100% 4.950 3.465 N Arhgef3 n/a
6 TRCN0000351813 GCGATCTTTGAACTTTCTCAA pLKO_005 597 CDS 100% 4.950 3.465 N Arhgef3 n/a
7 TRCN0000110047 GCGCTGTTTAGAATCACCCTT pLKO.1 938 CDS 100% 2.640 1.848 N Arhgef3 n/a
8 TRCN0000110046 CCAGGGAATTGTGGCAGAAAT pLKO.1 1103 CDS 100% 13.200 7.920 N Arhgef3 n/a
9 TRCN0000351815 CCAGGGAATTGTGGCAGAAAT pLKO_005 1103 CDS 100% 13.200 7.920 N Arhgef3 n/a
10 TRCN0000047547 CCCATGCTGAAACTCTCCATA pLKO.1 672 CDS 100% 4.950 2.970 N ARHGEF3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519579.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03149 pDONR223 100% 82% 86% None (many diffs) n/a
2 ccsbBroad304_03149 pLX_304 0% 82% 86% V5 (many diffs) n/a
3 TRCN0000476018 ACGGCTAGCTGTTATCGGGTACTC pLX_317 24.4% 82% 86% V5 (many diffs) n/a
4 ccsbBroadEn_11925 pDONR223 100% 51.2% 54.7% None (many diffs) n/a
5 ccsbBroad304_11925 pLX_304 0% 51.2% 54.7% V5 (many diffs) n/a
6 TRCN0000474076 TTTTGCCACTACTCGGCCACGTTG pLX_317 39.2% 51.2% 54.7% V5 (many diffs) n/a
Download CSV