Transcript: Mouse XM_006519661.3

PREDICTED: Mus musculus zinc finger, DHHC domain containing 20 (Zdhhc20), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zdhhc20 (75965)
Length:
5595
CDS:
369..1730

Additional Resources:

NCBI RefSeq record:
XM_006519661.3
NBCI Gene record:
Zdhhc20 (75965)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519661.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000328623 AGCTGTGCGTGAGTACTATTT pLKO_005 760 CDS 100% 13.200 18.480 N Zdhhc20 n/a
2 TRCN0000125165 CCGTTGTTTACCTTGTGGCTT pLKO.1 805 CDS 100% 2.640 2.112 N Zdhhc20 n/a
3 TRCN0000139390 CCGTTGTTTACCTTGTGGCTT pLKO.1 805 CDS 100% 2.640 2.112 N ZDHHC20 n/a
4 TRCN0000328698 TCAGTGTGCTCTCACTATTTA pLKO_005 1327 CDS 100% 15.000 10.500 N Zdhhc20 n/a
5 TRCN0000125167 AGTGACTACGTCAGAAGTATT pLKO.1 1590 CDS 100% 13.200 9.240 N Zdhhc20 n/a
6 TRCN0000328696 CTTCAAAGGCTATCCGATATT pLKO_005 1015 CDS 100% 13.200 9.240 N Zdhhc20 n/a
7 TRCN0000125168 CCATCTGTTCTTTGTTATGTT pLKO.1 827 CDS 100% 5.625 3.938 N Zdhhc20 n/a
8 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 3195 3UTR 100% 4.050 2.025 Y Mtif2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519661.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13454 pDONR223 100% 63.1% 63.5% None (many diffs) n/a
2 ccsbBroad304_13454 pLX_304 0% 63.1% 63.5% V5 (many diffs) n/a
3 TRCN0000480184 TCAAACCCCGATCCACCTAGCGGA pLX_317 43.3% 63.1% 63.5% V5 (many diffs) n/a
4 ccsbBroadEn_16134 pDONR223 0% 25.1% 25.6% None (many diffs) n/a
5 ccsbBroad304_16134 pLX_304 0% 25.1% 25.6% V5 (many diffs) n/a
6 TRCN0000467481 CCATACTTCGACACTAGACACCGT pLX_317 76.5% 25.1% 25.6% V5 (many diffs) n/a
Download CSV