Transcript: Mouse XM_006519755.3

PREDICTED: Mus musculus predicted gene 2260 (Gm2260), mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm2260 (100039484)
Length:
1682
CDS:
490..948

Additional Resources:

NCBI RefSeq record:
XM_006519755.3
NBCI Gene record:
Gm2260 (100039484)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519755.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110724 CTATCGAAAGATTCTACTGAA pLKO.1 906 CDS 100% 4.950 2.475 Y Anxa11 n/a
2 TRCN0000110720 GCGTATTTACTGTATCGTGTT pLKO.1 1333 3UTR 100% 4.050 2.025 Y Anxa11 n/a
3 TRCN0000110721 CCGAGACATTGAGAAGAGCAT pLKO.1 639 CDS 100% 2.640 1.320 Y Anxa11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519755.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00073 pDONR223 100% 27.2% 28.7% None (many diffs) n/a
2 ccsbBroad304_00073 pLX_304 0% 27.2% 28.7% V5 (many diffs) n/a
3 TRCN0000470292 ACGCGCCCGATCCCCACTTCCAAT pLX_317 31.5% 27.2% 28.7% V5 (many diffs) n/a
Download CSV