Transcript: Mouse XM_006520107.3

PREDICTED: Mus musculus neurocalcin delta (Ncald), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ncald (52589)
Length:
3699
CDS:
550..1131

Additional Resources:

NCBI RefSeq record:
XM_006520107.3
NBCI Gene record:
Ncald (52589)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520107.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104697 GCAAACGGTGATGGGACAATA pLKO.1 769 CDS 100% 13.200 18.480 N Ncald n/a
2 TRCN0000327189 GCAAACGGTGATGGGACAATA pLKO_005 769 CDS 100% 13.200 18.480 N Ncald n/a
3 TRCN0000104698 CGCCAGATGGATACCAATAGA pLKO.1 1009 CDS 100% 5.625 7.875 N Ncald n/a
4 TRCN0000327295 CGCCAGATGGATACCAATAGA pLKO_005 1009 CDS 100% 5.625 7.875 N Ncald n/a
5 TRCN0000104695 GCCAGGTGATTCACCCATTAT pLKO.1 2405 3UTR 100% 13.200 9.240 N Ncald n/a
6 TRCN0000327294 GCCAGGTGATTCACCCATTAT pLKO_005 2405 3UTR 100% 13.200 9.240 N Ncald n/a
7 TRCN0000150364 CAAATTTGCAGAGCATGTCTT pLKO.1 735 CDS 100% 4.950 3.465 N NCALD n/a
8 TRCN0000104699 GCTTCCAAATTTGCAGAGCAT pLKO.1 730 CDS 100% 2.640 1.848 N Ncald n/a
9 TRCN0000327293 GCTTCCAAATTTGCAGAGCAT pLKO_005 730 CDS 100% 2.640 1.848 N Ncald n/a
10 TRCN0000104696 CCTGAAGTCATGCAGGACTTA pLKO.1 577 CDS 100% 0.495 0.347 N Ncald n/a
11 TRCN0000327213 CCTGAAGTCATGCAGGACTTA pLKO_005 577 CDS 100% 0.495 0.347 N Ncald n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520107.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04313 pDONR223 100% 92.5% 100% None (many diffs) n/a
2 ccsbBroad304_04313 pLX_304 0% 92.5% 100% V5 (many diffs) n/a
3 TRCN0000473557 GCAATCGGCAAAAGCGCAATCTTG pLX_317 62.9% 92.5% 100% V5 (many diffs) n/a
4 ccsbBroadEn_09142 pDONR223 100% 92.4% 99.4% None (many diffs) n/a
5 ccsbBroad304_09142 pLX_304 0% 92.4% 99.4% V5 (many diffs) n/a
6 TRCN0000471437 TGCCTCGGTCCCGTGACACTAACA pLX_317 79.1% 92.4% 99.4% V5 (many diffs) n/a
Download CSV