Transcript: Mouse XM_006520231.3

PREDICTED: Mus musculus anoctamin 6 (Ano6), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ano6 (105722)
Length:
5974
CDS:
447..3203

Additional Resources:

NCBI RefSeq record:
XM_006520231.3
NBCI Gene record:
Ano6 (105722)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520231.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215439 GAATCTAATTGGACGATATAA pLKO.1 2360 CDS 100% 15.000 21.000 N Ano6 n/a
2 TRCN0000250222 GAATCTAATTGGACGATATAA pLKO_005 2360 CDS 100% 15.000 21.000 N Ano6 n/a
3 TRCN0000250220 GGCTCACCCTCGGAGTATATA pLKO_005 1286 CDS 100% 15.000 21.000 N Ano6 n/a
4 TRCN0000250221 GTTGATCTGAACGGTTAATTT pLKO_005 3983 3UTR 100% 15.000 21.000 N Ano6 n/a
5 TRCN0000258029 CTGTCCGTGTTCATCGTATTT pLKO_005 1902 CDS 100% 13.200 18.480 N Ano6 n/a
6 TRCN0000173331 GCACATCAAACTCCCGCTAAA pLKO.1 893 CDS 100% 10.800 15.120 N Ano6 n/a
7 TRCN0000175054 GCCTCTGTGTTATCAACAATA pLKO.1 3632 3UTR 100% 13.200 10.560 N Ano6 n/a
8 TRCN0000250223 CAAGGACCCAGACGGATTATG pLKO_005 2089 CDS 100% 13.200 9.240 N Ano6 n/a
9 TRCN0000173761 CCCATACATTGGGCTTGGTAA pLKO.1 2855 CDS 100% 4.950 3.465 N Ano6 n/a
10 TRCN0000134775 CCTTGGATCTTATCAGGAAAT pLKO.1 1318 CDS 100% 10.800 7.560 N ANO6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520231.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09792 pDONR223 100% 81.7% 87.7% None (many diffs) n/a
2 ccsbBroad304_09792 pLX_304 0% 81.7% 87.7% V5 (many diffs) n/a
3 TRCN0000477050 CAAAGAATCCAGTTCCGTGAGCGG pLX_317 15.4% 81.7% 87.7% V5 (many diffs) n/a
Download CSV