Transcript: Mouse XM_006520260.2

PREDICTED: Mus musculus family with sequence similarity 19, member A5 (Fam19a5), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam19a5 (106014)
Length:
1205
CDS:
119..766

Additional Resources:

NCBI RefSeq record:
XM_006520260.2
NBCI Gene record:
Fam19a5 (106014)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520260.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000283025 TTGTGTGGACGCTCGAATTAT pLKO_005 370 CDS 100% 15.000 21.000 N Fam19a5 n/a
2 TRCN0000201896 CTTGTGTGGACGCTCGAATTA pLKO.1 369 CDS 100% 13.200 18.480 N Fam19a5 n/a
3 TRCN0000190105 GACAAAGCAGTGGTGTGACAT pLKO.1 394 CDS 100% 4.950 3.465 N Fam19a5 n/a
4 TRCN0000264391 TGTGAGATTGTGACCCTAGAC pLKO_005 251 CDS 100% 4.050 2.835 N Fam19a5 n/a
5 TRCN0000200727 GAATTATCAAGACAAAGCAGT pLKO.1 384 CDS 100% 2.640 1.848 N Fam19a5 n/a
6 TRCN0000264392 GAAGGCTGTGACTTGTTAATC pLKO_005 434 CDS 100% 13.200 7.920 N Fam19a5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520260.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11769 pDONR223 100% 48.3% 52.5% None (many diffs) n/a
2 ccsbBroad304_11769 pLX_304 0% 48.3% 52.5% V5 (many diffs) n/a
3 TRCN0000475654 GGCCGTGCTGTTACGGCAGAGCGA pLX_317 82.7% 48.3% 52.5% V5 (many diffs) n/a
Download CSV