Transcript: Mouse XM_006520323.2

PREDICTED: Mus musculus angiopoietin 1 (Angpt1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Angpt1 (11600)
Length:
3591
CDS:
86..1288

Additional Resources:

NCBI RefSeq record:
XM_006520323.2
NBCI Gene record:
Angpt1 (11600)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520323.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068218 CCCAGGTACTAAATCAAACAT pLKO.1 240 CDS 100% 5.625 7.875 N Angpt1 n/a
2 TRCN0000068222 GCTTGGTTTCTCGTCAGACAT pLKO.1 453 CDS 100% 4.950 3.465 N Angpt1 n/a
3 TRCN0000068220 CCCTTCCAATCTAAATGGAAT pLKO.1 1150 CDS 100% 0.495 0.347 N Angpt1 n/a
4 TRCN0000058638 CCCAGGTACTAAATCAAACTT pLKO.1 240 CDS 100% 5.625 7.875 N ANGPT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520323.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10677 pDONR223 100% 34% 36% None (many diffs) n/a
2 ccsbBroad304_10677 pLX_304 0% 34% 36% V5 (many diffs) n/a
3 TRCN0000475147 TCATGCGTAATGATATACTCGCGC pLX_317 98.2% 34% 36% V5 (many diffs) n/a
Download CSV