Transcript: Mouse XM_006520831.3

PREDICTED: Mus musculus ceramide kinase (Cerk), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cerk (223753)
Length:
4005
CDS:
575..1576

Additional Resources:

NCBI RefSeq record:
XM_006520831.3
NBCI Gene record:
Cerk (223753)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520831.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000363408 TCACTACGGAGATCATCATTA pLKO_005 468 5UTR 100% 13.200 18.480 N Cerk n/a
2 TRCN0000025594 CGTTGAAGTTTATCGAGTCAA pLKO.1 1327 CDS 100% 4.950 6.930 N Cerk n/a
3 TRCN0000362072 GGATCTCCACGGGACAATAAA pLKO_005 995 CDS 100% 15.000 10.500 N Cerk n/a
4 TRCN0000362018 CATCGGCTTTGCACATCATTA pLKO_005 747 CDS 100% 13.200 9.240 N Cerk n/a
5 TRCN0000379378 TCCAGTGGCCGATGGCATAAA pLKO_005 114 5UTR 100% 13.200 9.240 N Cerk n/a
6 TRCN0000025598 CCACAGATTGTGTGTGTTACT pLKO.1 699 CDS 100% 4.950 3.465 N Cerk n/a
7 TRCN0000025596 GACTTAATCAAGGACAGTGAA pLKO.1 863 CDS 100% 4.950 3.465 N Cerk n/a
8 TRCN0000025597 GTATGATTTCTCAGGGTTGAA pLKO.1 910 CDS 100% 4.950 3.465 N Cerk n/a
9 TRCN0000025595 CGAGATCAACACAGACAGCTA pLKO.1 523 5UTR 100% 2.640 1.848 N Cerk n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520831.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487882 ATGTCATAAATAATTCATTCATCT pLX_317 20.1% 51.2% 53.2% V5 (many diffs) n/a
2 TRCN0000488156 ATCAAAAGTCGAGTTTGTGCACTG pLX_317 20.3% 51.2% 53.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV