Transcript: Mouse XM_006520833.2

PREDICTED: Mus musculus TBC1 domain family, member 22a (Tbc1d22a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tbc1d22a (223754)
Length:
3296
CDS:
280..1734

Additional Resources:

NCBI RefSeq record:
XM_006520833.2
NBCI Gene record:
Tbc1d22a (223754)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520833.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250077 ACGTATCGCCAGATCCATATC pLKO_005 1102 CDS 100% 10.800 15.120 N Tbc1d22a n/a
2 TRCN0000184011 CCGTTTGATCCGCTGTTACAT pLKO.1 373 CDS 100% 5.625 7.875 N Tbc1d22a n/a
3 TRCN0000138669 GACAACTACACCTTTGCCCAA pLKO.1 1402 CDS 100% 2.160 3.024 N TBC1D22A n/a
4 TRCN0000250074 TGGATACGTTCAGGGAATAAA pLKO_005 1224 CDS 100% 15.000 12.000 N Tbc1d22a n/a
5 TRCN0000250076 CACCGTTTGATCCGCTGTTAC pLKO_005 371 CDS 100% 10.800 7.560 N Tbc1d22a n/a
6 TRCN0000250075 TTCAGAGAGCACCGGTGATAC pLKO_005 732 CDS 100% 10.800 7.560 N Tbc1d22a n/a
7 TRCN0000180860 GCAGCCTAGTTTGATGAGATA pLKO.1 1873 3UTR 100% 4.950 3.465 N Tbc1d22a n/a
8 TRCN0000184141 CCAACACAGACCTTGAGGAAT pLKO.1 899 CDS 100% 4.950 2.970 N Tbc1d22a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520833.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11765 pDONR223 100% 68% 71.3% None (many diffs) n/a
2 ccsbBroad304_11765 pLX_304 0% 68% 71.3% V5 (many diffs) n/a
3 TRCN0000472194 AAATCCCGAAGCATGGTTGGCACC pLX_317 38.7% 68% 71.3% V5 (many diffs) n/a
Download CSV