Transcript: Mouse XM_006521249.3

PREDICTED: Mus musculus glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding) (Grina), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Grina (66168)
Length:
1865
CDS:
285..1322

Additional Resources:

NCBI RefSeq record:
XM_006521249.3
NBCI Gene record:
Grina (66168)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521249.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119669 GAACCTGTACACGGACATCAT pLKO.1 1253 CDS 100% 4.950 3.465 N Grina n/a
2 TRCN0000119668 GCCTCCATCCTACTATGACAA pLKO.1 620 CDS 100% 4.950 3.465 N Grina n/a
3 TRCN0000119671 CTGGACCTACTATGTCTCCTA pLKO.1 797 CDS 100% 2.640 1.848 N Grina n/a
4 TRCN0000119670 CTTCCTATATATTCTCACCAT pLKO.1 1280 CDS 100% 2.640 1.848 N Grina n/a
5 TRCN0000119667 GCTGCATTTCTGTGCCACCTT pLKO.1 1542 3UTR 100% 2.640 1.584 N Grina n/a
6 TRCN0000063595 TGGACCTACTATGTCTCCTAT pLKO.1 798 CDS 100% 4.950 3.465 N GRINA n/a
7 TRCN0000063593 GTGCTCTTCATCTTCGCCATT pLKO.1 1080 CDS 100% 4.050 2.835 N GRINA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521249.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00692 pDONR223 100% 84.1% 87.6% None (many diffs) n/a
2 ccsbBroad304_00692 pLX_304 0% 84.1% 87.6% V5 (many diffs) n/a
3 TRCN0000476643 CTTTACAACCGGTCCTGCCTGGAC pLX_317 25% 84.1% 87.6% V5 (many diffs) n/a
Download CSV