Transcript: Mouse XM_006521308.3

PREDICTED: Mus musculus TraB domain containing (Trabd), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Trabd (67976)
Length:
1862
CDS:
58..1188

Additional Resources:

NCBI RefSeq record:
XM_006521308.3
NBCI Gene record:
Trabd (67976)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521308.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251037 GACGTCTATCTGACCTATATG pLKO_005 832 CDS 100% 13.200 18.480 N Trabd n/a
2 TRCN0000251035 CCAATCCCAGTCACCTTTAAG pLKO_005 628 CDS 100% 13.200 10.560 N Trabd n/a
3 TRCN0000191309 CCCACCCAAATAAAGAATATT pLKO.1 1357 3UTR 100% 15.000 10.500 N Trabd n/a
4 TRCN0000275622 AGATGATGGCCGAGATGATTG pLKO_005 770 CDS 100% 10.800 7.560 N TRABD n/a
5 TRCN0000251034 AGTTCAGGGAGGCCTTCAAAG pLKO_005 563 CDS 100% 10.800 7.560 N Trabd n/a
6 TRCN0000251036 TGTCAGGCAGAATGGGCTTAT pLKO_005 465 CDS 100% 10.800 7.560 N Trabd n/a
7 TRCN0000190051 GTCACCTTTAAGAGGGCCATT pLKO.1 637 CDS 100% 4.050 2.835 N Trabd n/a
8 TRCN0000190588 GCATTGAGAAGAACTGGAGTA pLKO.1 962 CDS 100% 4.050 2.430 N Trabd n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521308.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12690 pDONR223 100% 75.8% 81.4% None (many diffs) n/a
2 ccsbBroad304_12690 pLX_304 0% 75.8% 81.4% V5 (many diffs) n/a
3 TRCN0000481519 TAATGAGTTTGACGAACTTCATAA pLX_317 33.6% 75.8% 81.4% V5 (many diffs) n/a
Download CSV