Transcript: Mouse XM_006521351.2

PREDICTED: Mus musculus solute carrier family 38, member 4 (Slc38a4), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc38a4 (69354)
Length:
2969
CDS:
153..1796

Additional Resources:

NCBI RefSeq record:
XM_006521351.2
NBCI Gene record:
Slc38a4 (69354)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521351.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068819 CGGAAATCTGACGTTCAACAA pLKO.1 926 CDS 100% 4.950 6.930 N Slc38a4 n/a
2 TRCN0000354083 CGGAAATCTGACGTTCAACAA pLKO_005 926 CDS 100% 4.950 6.930 N Slc38a4 n/a
3 TRCN0000068822 GACGCCATGAACAGCCAATTT pLKO.1 258 CDS 100% 13.200 9.240 N Slc38a4 n/a
4 TRCN0000326157 GACGCCATGAACAGCCAATTT pLKO_005 258 CDS 100% 13.200 9.240 N Slc38a4 n/a
5 TRCN0000068820 CGTGCCTACCATCAAATACAT pLKO.1 1562 CDS 100% 5.625 3.938 N Slc38a4 n/a
6 TRCN0000068818 GCCTGAAGTAATCAGAGCATT pLKO.1 683 CDS 100% 4.950 3.465 N Slc38a4 n/a
7 TRCN0000326087 GCCTGAAGTAATCAGAGCATT pLKO_005 683 CDS 100% 4.950 3.465 N Slc38a4 n/a
8 TRCN0000068821 CCTTTGGAATGTCCTCATTTA pLKO.1 379 CDS 100% 13.200 6.600 Y Slc38a4 n/a
9 TRCN0000326086 CCTTTGGAATGTCCTCATTTA pLKO_005 379 CDS 100% 13.200 6.600 Y Slc38a4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521351.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08467 pDONR223 100% 82.6% 87% None (many diffs) n/a
2 ccsbBroad304_08467 pLX_304 0% 82.6% 87% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000476589 ATCGAACACGTTAAGGCTATAGCC pLX_317 25.2% 82.6% 87% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV