Transcript: Mouse XM_006521529.1

PREDICTED: Mus musculus EFR3 homolog A (Efr3a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Efr3a (76740)
Length:
5298
CDS:
393..2744

Additional Resources:

NCBI RefSeq record:
XM_006521529.1
NBCI Gene record:
Efr3a (76740)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521529.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276924 ACGTCTGGTGGACAACATATT pLKO_005 268 5UTR 100% 13.200 18.480 N Efr3a n/a
2 TRCN0000285802 CCGTTCTGGGTACGTTCTAAT pLKO_005 491 CDS 100% 13.200 18.480 N Efr3a n/a
3 TRCN0000216789 GATTCGCATTGCTGGAATAAG pLKO.1 773 CDS 100% 13.200 18.480 N Efr3a n/a
4 TRCN0000194436 GCCAGCATGTTAGCAAGGTTA pLKO.1 2131 CDS 100% 4.950 6.930 N Efr3a n/a
5 TRCN0000216207 CATGATAGACTTGCTCAAATA pLKO.1 2601 CDS 100% 13.200 9.240 N Efr3a n/a
6 TRCN0000175048 GTATCTATTCAGGTGGATATT pLKO.1 2385 CDS 100% 13.200 9.240 N Efr3a n/a
7 TRCN0000276923 GTATCTATTCAGGTGGATATT pLKO_005 2385 CDS 100% 13.200 9.240 N Efr3a n/a
8 TRCN0000175125 CCTGTTCAAATTCAGTTTCTT pLKO.1 3891 3UTR 100% 5.625 3.938 N Efr3a n/a
9 TRCN0000175694 GCTGCTGATTAAGTGCAGATA pLKO.1 4191 3UTR 100% 4.950 3.465 N Efr3a n/a
10 TRCN0000297101 GCTGCTGATTAAGTGCAGATA pLKO_005 4191 3UTR 100% 4.950 3.465 N Efr3a n/a
11 TRCN0000193740 CAAGAGATTCTAGGACACCTT pLKO.1 1164 CDS 100% 2.640 1.848 N Efr3a n/a
12 TRCN0000276922 CAAGAGATTCTAGGACACCTT pLKO_005 1164 CDS 100% 2.640 1.848 N Efr3a n/a
13 TRCN0000158956 GCGCATTTAGATCATCACAAA pLKO.1 1059 CDS 100% 4.950 6.930 N EFR3A n/a
14 TRCN0000038089 GCTGACAAAGAAGAGAACCAA pLKO.1 954 CDS 100% 3.000 2.100 N NOP53 n/a
15 TRCN0000299041 GCTGACAAAGAAGAGAACCAA pLKO_005 954 CDS 100% 3.000 2.100 N NOP53 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521529.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.