Transcript: Mouse XM_006521657.3

PREDICTED: Mus musculus ets variant 5 (Etv5), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Etv5 (104156)
Length:
4978
CDS:
1522..3054

Additional Resources:

NCBI RefSeq record:
XM_006521657.3
NBCI Gene record:
Etv5 (104156)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521657.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000349768 TACATGAGAGGCGGGTATTTC pLKO_005 2455 CDS 100% 13.200 18.480 N Etv5 n/a
2 TRCN0000312868 CCGAAGGCTTCGCTTACTAAG pLKO_005 3035 CDS 100% 10.800 15.120 N Etv5 n/a
3 TRCN0000054784 ACAACTATTGTGCCTACGATA pLKO.1 1874 CDS 100% 4.950 6.930 N Etv5 n/a
4 TRCN0000311818 ACAACTATTGTGCCTACGATA pLKO_005 1874 CDS 100% 4.950 6.930 N Etv5 n/a
5 TRCN0000054783 GCGACCTTTGATTGACAGAAA pLKO.1 1593 CDS 100% 4.950 6.930 N Etv5 n/a
6 TRCN0000054785 CAGTCTGATAACTTGGTGCTT pLKO.1 1741 CDS 100% 2.640 2.112 N Etv5 n/a
7 TRCN0000312867 AGCTTGCCCTTTGAGTATTAT pLKO_005 3151 3UTR 100% 15.000 10.500 N Etv5 n/a
8 TRCN0000312912 CACCTCCCACCAAGATCAAAC pLKO_005 1769 CDS 100% 10.800 7.560 N Etv5 n/a
9 TRCN0000054786 AGGAAGTTTGTGGACACAGAT pLKO.1 1615 CDS 100% 4.950 3.465 N Etv5 n/a
10 TRCN0000054787 GCCAGCCATGAACTATGACAA pLKO.1 2763 CDS 100% 4.950 2.970 N Etv5 n/a
11 TRCN0000013940 CTCTACAACTATTGTGCCTAT pLKO.1 1870 CDS 100% 4.050 2.835 N ETV5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521657.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00521 pDONR223 100% 90% 95.4% None (many diffs) n/a
2 ccsbBroad304_00521 pLX_304 0% 90% 95.4% V5 (many diffs) n/a
3 TRCN0000467138 TTCGAGCCTGTGGTCAGAATCACT pLX_317 26.9% 90% 95.4% V5 (many diffs) n/a
Download CSV