Transcript: Mouse XM_006521773.2

PREDICTED: Mus musculus discs, large homolog 1 (Drosophila) (Dlg1), transcript variant X17, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dlg1 (13383)
Length:
5956
CDS:
2018..4387

Additional Resources:

NCBI RefSeq record:
XM_006521773.2
NBCI Gene record:
Dlg1 (13383)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521773.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321799 ACCCGACCAGTCATCATATTA pLKO_005 3812 CDS 100% 15.000 21.000 N Dlg1 n/a
2 TRCN0000321798 GTCACCATCGTTGCGCAATAT pLKO_005 3284 CDS 100% 13.200 18.480 N Dlg1 n/a
3 TRCN0000321863 GTTGCATCATCTGTACTATTC pLKO_005 4531 3UTR 100% 10.800 15.120 N Dlg1 n/a
4 TRCN0000025406 CCAGTATAACAACCATCTGTA pLKO.1 4018 CDS 100% 4.950 6.930 N Dlg1 n/a
5 TRCN0000025408 GCAGGAGTTCACTGAGCATTT pLKO.1 4255 CDS 100% 10.800 7.560 N Dlg1 n/a
6 TRCN0000025407 GCACTGATGCAGATTATGAAT pLKO.1 2313 CDS 100% 5.625 3.938 N Dlg1 n/a
7 TRCN0000025405 CCAGTGAATCAACAAGAAGTT pLKO.1 3785 CDS 100% 4.950 3.465 N Dlg1 n/a
8 TRCN0000091448 CCTCCCAAGTACTGGGATTAA pLKO.1 86 5UTR 100% 1.320 0.660 Y Epb42 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521773.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14615 pDONR223 52.1% 74.1% 5.9% None (many diffs) n/a
2 ccsbBroad304_14615 pLX_304 0% 74.1% 5.9% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000471116 TTCGAAGCCCGGCTAAACTAAATC pLX_317 13.6% 74.1% 5.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV