Transcript: Mouse XM_006521777.2

PREDICTED: Mus musculus dopamine receptor D3 (Drd3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Drd3 (13490)
Length:
2637
CDS:
194..1630

Additional Resources:

NCBI RefSeq record:
XM_006521777.2
NBCI Gene record:
Drd3 (13490)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521777.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221282 GCTCAGCTTAGAGGTTCGAAA pLKO.1 1306 CDS 100% 4.950 6.930 N Drd3 n/a
2 TRCN0000011345 GTCTGGAATTTCAGCCGCATT pLKO.1 572 CDS 100% 4.050 5.670 N DRD3 n/a
3 TRCN0000440828 ACAGGTGGAGTCTGGAATTTC pLKO_005 563 CDS 100% 13.200 9.240 N Drd3 n/a
4 TRCN0000221283 CCCTCTCCTCTTTGGTTTCAA pLKO.1 787 CDS 100% 5.625 3.938 N Drd3 n/a
5 TRCN0000221285 ACGGGACAAATGGAGCACATA pLKO.1 1079 CDS 100% 4.950 3.465 N Drd3 n/a
6 TRCN0000221284 GACCCTCTCTTGTCACATCTA pLKO.1 1130 CDS 100% 4.950 3.465 N Drd3 n/a
7 TRCN0000221281 CCCTTCTTCTTGACTCACGTT pLKO.1 1457 CDS 100% 2.640 1.848 N Drd3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521777.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488434 ACTTCACCCGGCAGTGTAAATTTG pLX_317 29.1% 72.8% 75.7% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000491549 AAACCACCCTGCTGTGAGTCTTTG pLX_317 25.8% 72.8% 75.6% V5 (many diffs) n/a
3 ccsbBroadEn_06121 pDONR223 100% 72.7% 75.3% None (many diffs) n/a
4 ccsbBroad304_06121 pLX_304 0% 72.7% 75.3% V5 (many diffs) n/a
5 TRCN0000476045 TCCGATGTCGAATGTTTCCGGTAT pLX_317 27% 72.7% 75.3% V5 (many diffs) n/a
Download CSV