Transcript: Mouse XM_006521794.3

PREDICTED: Mus musculus glutamate receptor, ionotropic, NMDA2A (epsilon 1) (Grin2a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Grin2a (14811)
Length:
7070
CDS:
1888..6282

Additional Resources:

NCBI RefSeq record:
XM_006521794.3
NBCI Gene record:
Grin2a (14811)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521794.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100265 CCCAACAATGACCAGTATAAA pLKO.1 5422 CDS 100% 15.000 21.000 N Grin2a n/a
2 TRCN0000100266 GCCAGACCATACCTCTGATAA pLKO.1 5961 CDS 100% 13.200 18.480 N Grin2a n/a
3 TRCN0000100269 GCCACAGTGATGTGTATATTT pLKO.1 6140 CDS 100% 15.000 10.500 N Grin2a n/a
4 TRCN0000100267 GCACCAGTACATGACCAAATT pLKO.1 3990 CDS 100% 13.200 9.240 N Grin2a n/a
5 TRCN0000100268 CGGCTACGATTTCTTCTGGAT pLKO.1 2634 CDS 100% 2.640 1.848 N Grin2a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521794.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492327 TAGTGGACTAGGTAGTCAATGGTC pLX_317 9.5% 88.8% 95.2% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_00691 pDONR223 100% 77.5% 82.7% None (many diffs) n/a
3 ccsbBroad304_00691 pLX_304 0% 77.5% 82.7% V5 (many diffs) n/a
4 TRCN0000468211 CCTTCACAAATCATTCCAAACCGG pLX_317 11.7% 77.5% 82.7% V5 (many diffs) n/a
Download CSV