Transcript: Mouse XM_006521825.3

PREDICTED: Mus musculus solute carrier family 12 (potassium/chloride transporters), member 8 (Slc12a8), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc12a8 (171286)
Length:
2951
CDS:
77..2047

Additional Resources:

NCBI RefSeq record:
XM_006521825.3
NBCI Gene record:
Slc12a8 (171286)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521825.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079287 CCCTACAAGATAGCTTCCTCT pLKO.1 1422 CDS 100% 2.640 3.696 N Slc12a8 n/a
2 TRCN0000079284 GCCCTTGTGTATTTCTACATT pLKO.1 1775 CDS 100% 5.625 3.938 N Slc12a8 n/a
3 TRCN0000079283 GCCAGATACTAGGTATGACTA pLKO.1 2211 3UTR 100% 4.950 3.465 N Slc12a8 n/a
4 TRCN0000079285 GCTTGGGTCAAGAGAAGGAAA pLKO.1 1354 CDS 100% 4.950 3.465 N Slc12a8 n/a
5 TRCN0000042999 CCTACAAGATAGCTTCCTCTT pLKO.1 1423 CDS 100% 4.050 2.835 N SLC12A8 n/a
6 TRCN0000079286 GCGTGGAATTTCAGTTGCTGT pLKO.1 544 CDS 100% 2.640 1.848 N Slc12a8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521825.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.