Transcript: Mouse XM_006521828.3

PREDICTED: Mus musculus mannan-binding lectin serine peptidase 1 (Masp1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Masp1 (17174)
Length:
4212
CDS:
525..2726

Additional Resources:

NCBI RefSeq record:
XM_006521828.3
NBCI Gene record:
Masp1 (17174)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521828.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032625 CGTGGAGCTAAACGAAATGTT pLKO.1 602 CDS 100% 5.625 7.875 N Masp1 n/a
2 TRCN0000032628 GCTATCCAGATTCCTATCCAA pLKO.1 643 CDS 100% 3.000 4.200 N Masp1 n/a
3 TRCN0000032624 CCTGTCCCTATGACTACATTA pLKO.1 1261 CDS 100% 13.200 10.560 N Masp1 n/a
4 TRCN0000032626 CCACATACAAATCTGAGATAA pLKO.1 1699 CDS 100% 13.200 9.240 N Masp1 n/a
5 TRCN0000166364 CACACACACACACACACACAA pLKO.1 165 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521828.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06786 pDONR223 100% 86% 89.4% None (many diffs) n/a
2 ccsbBroad304_06786 pLX_304 0% 86% 89.4% V5 (many diffs) n/a
3 TRCN0000474736 GAAGCAAGCTATATACGATGATGT pLX_317 17.3% 86% 89.4% V5 (many diffs) n/a
Download CSV