Transcript: Mouse XM_006522116.3

PREDICTED: Mus musculus Mab-21 domain containing 2 (Mb21d2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mb21d2 (239796)
Length:
2935
CDS:
41..1366

Additional Resources:

NCBI RefSeq record:
XM_006522116.3
NBCI Gene record:
Mb21d2 (239796)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006522116.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424142 CCATTTCAGAATCGATGATAA pLKO_005 1336 CDS 100% 13.200 18.480 N Mb21d2 n/a
2 TRCN0000438211 TGCGGGCTCTGAAACAGTATT pLKO_005 1507 3UTR 100% 13.200 18.480 N Mb21d2 n/a
3 TRCN0000195924 CCTCTCGGAGATACAGAAGAA pLKO.1 475 CDS 100% 4.950 6.930 N Mb21d2 n/a
4 TRCN0000182919 CCTAGATGAGTTAAACGTCTA pLKO.1 193 CDS 100% 4.050 5.670 N Mb21d2 n/a
5 TRCN0000184406 CCAACGAGTATCTGTTGCTCT pLKO.1 138 CDS 100% 2.640 3.696 N Mb21d2 n/a
6 TRCN0000183764 CCCTAATTATTTCATCCCTCA pLKO.1 1012 CDS 100% 2.160 1.728 N Mb21d2 n/a
7 TRCN0000439204 GCATGCTGGCTGCGTTTATTT pLKO_005 1824 3UTR 100% 15.000 10.500 N Mb21d2 n/a
8 TRCN0000217447 GCAAAGCCATCATCATCAAAC pLKO.1 828 CDS 100% 10.800 7.560 N Mb21d2 n/a
9 TRCN0000184582 GAAGACTATGCAGCCCACTTT pLKO.1 941 CDS 100% 4.950 3.465 N Mb21d2 n/a
10 TRCN0000179248 GTCAACAAGATGTGCCCTAAT pLKO.1 998 CDS 100% 10.800 6.480 N Mb21d2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006522116.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05059 pDONR223 100% 77.4% 84.8% None (many diffs) n/a
2 ccsbBroad304_05059 pLX_304 0% 77.4% 84.8% V5 (many diffs) n/a
3 TRCN0000476023 AAGCTCTACACTTCCGCTACTCGA pLX_317 18.1% 77.4% 84.8% V5 (many diffs) n/a
Download CSV