Transcript: Mouse XM_006522467.1

PREDICTED: Mus musculus cell death inducing Trp53 target 1 (Cdip1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cdip1 (66626)
Length:
2550
CDS:
226..852

Additional Resources:

NCBI RefSeq record:
XM_006522467.1
NBCI Gene record:
Cdip1 (66626)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006522467.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095761 CACCCACCTATGGGCTATTAT pLKO.1 490 CDS 100% 15.000 21.000 N Cdip1 n/a
2 TRCN0000257336 GAGTCGTGCCCAGGGTATAAA pLKO_005 1865 3UTR 100% 15.000 21.000 N Cdip1 n/a
3 TRCN0000095762 CGGCCACAGTATTGGTCCCAT pLKO.1 560 CDS 100% 0.880 0.704 N Cdip1 n/a
4 TRCN0000095759 CGCAGTTTGTAGTTTCATTAA pLKO.1 2010 3UTR 100% 13.200 9.240 N Cdip1 n/a
5 TRCN0000238041 TACTGCAGGGAGAGATCTTTG pLKO_005 605 CDS 100% 10.800 7.560 N Cdip1 n/a
6 TRCN0000238042 TGACCTGGGCTGCTGTTTGAT pLKO_005 744 CDS 100% 5.625 3.938 N Cdip1 n/a
7 TRCN0000257377 GAATGCAGATGGCACCTACAT pLKO_005 438 CDS 100% 4.950 3.465 N Cdip1 n/a
8 TRCN0000095763 GATGAACTTTGTGCTGGGTTT pLKO.1 702 CDS 100% 4.050 2.835 N Cdip1 n/a
9 TRCN0000238043 AGGCCATCACCACCAAGATCT pLKO_005 665 CDS 100% 4.950 2.970 N Cdip1 n/a
10 TRCN0000095760 CAAAGCCTACATCTGCACATA pLKO.1 816 CDS 100% 4.950 2.970 N Cdip1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006522467.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03119 pDONR223 100% 88.1% 94.2% None (many diffs) n/a
2 ccsbBroad304_03119 pLX_304 0% 88.1% 94.2% V5 (many diffs) n/a
3 TRCN0000471976 GTCTTGGCCGAGATCGTTTGCTGC pLX_317 61.9% 88.1% 94.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV