Transcript: Mouse XM_006522521.3

PREDICTED: Mus musculus forty-two-three domain containing 1 (Fyttd1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fyttd1 (69823)
Length:
3406
CDS:
113..991

Additional Resources:

NCBI RefSeq record:
XM_006522521.3
NBCI Gene record:
Fyttd1 (69823)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006522521.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102598 CGTCCCTCTACAGTTTGACAT pLKO.1 853 CDS 100% 4.950 6.930 N Fyttd1 n/a
2 TRCN0000102599 CCTATGAATCGTCCACCTCTA pLKO.1 464 CDS 100% 4.050 3.240 N Fyttd1 n/a
3 TRCN0000102595 CCTGAAAGAATAGCAGGGAAT pLKO.1 1161 3UTR 100% 4.050 3.240 N Fyttd1 n/a
4 TRCN0000102597 CCCTCTACAGTTTGACATAAA pLKO.1 856 CDS 100% 13.200 9.240 N Fyttd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006522521.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09162 pDONR223 100% 80.8% 84.2% None (many diffs) n/a
2 ccsbBroad304_09162 pLX_304 0% 80.8% 84.2% V5 (many diffs) n/a
3 TRCN0000473780 CGGCTGGCTCGACCGTGGAGCATT pLX_317 54.9% 80.8% 84.2% V5 (many diffs) n/a
Download CSV