Transcript: Mouse XM_006522624.1

PREDICTED: Mus musculus discoidin, CUB and LCCL domain containing 2 (Dcbld2), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dcbld2 (73379)
Length:
1775
CDS:
331..1650

Additional Resources:

NCBI RefSeq record:
XM_006522624.1
NBCI Gene record:
Dcbld2 (73379)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006522624.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097819 CAGAACGGAAATAGGCAAATA pLKO.1 741 CDS 100% 13.200 18.480 N Dcbld2 n/a
2 TRCN0000332556 CAGAACGGAAATAGGCAAATA pLKO_005 741 CDS 100% 13.200 18.480 N Dcbld2 n/a
3 TRCN0000097815 CCCATATTATGAAAGCTCTTT pLKO.1 1107 CDS 100% 4.950 3.465 N Dcbld2 n/a
4 TRCN0000332485 CCCATATTATGAAAGCTCTTT pLKO_005 1107 CDS 100% 4.950 3.465 N Dcbld2 n/a
5 TRCN0000097818 CGGATGTCAGTTTACTCTCAA pLKO.1 1585 CDS 100% 4.950 3.465 N Dcbld2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006522624.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13162 pDONR223 100% 43.7% 40.8% None (many diffs) n/a
2 ccsbBroad304_13162 pLX_304 0% 43.7% 40.8% V5 (many diffs) n/a
3 TRCN0000466300 CGGCAGCAAGTCATAGCTCGCCGG pLX_317 16.6% 43.7% 40.8% V5 (many diffs) n/a
Download CSV