Transcript: Mouse XM_006522695.3

PREDICTED: Mus musculus PEST proteolytic signal containing nuclear protein (Pcnp), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pcnp (76302)
Length:
2501
CDS:
158..817

Additional Resources:

NCBI RefSeq record:
XM_006522695.3
NBCI Gene record:
Pcnp (76302)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006522695.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241465 GAAGCTGTGGGAGCGAAATAT pLKO_005 757 CDS 100% 15.000 21.000 N Pcnp n/a
2 TRCN0000241464 GCGGGACCAAACTCCTTTAAT pLKO_005 707 CDS 100% 15.000 21.000 N Pcnp n/a
3 TRCN0000241461 TCCACGACCAAGACAATTAAG pLKO_005 798 CDS 100% 13.200 18.480 N Pcnp n/a
4 TRCN0000241463 ATTAGACTCGGAGCAAGTAAG pLKO_005 542 CDS 100% 10.800 15.120 N Pcnp n/a
5 TRCN0000241462 AGAAGCAGCCTGCGGATATTC pLKO_005 2193 3UTR 100% 13.200 9.240 N Pcnp n/a
6 TRCN0000330613 AGAAGCTGTGGGAGCGAAATA pLKO_005 756 CDS 100% 13.200 9.240 N PCNP n/a
7 TRCN0000141699 CCACCAGAACTTGAGGCAAAT pLKO.1 1600 3UTR 100% 10.800 7.560 N PCNP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006522695.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15117 pDONR223 75% 62.4% 62% None (many diffs) n/a
2 ccsbBroadEn_12327 pDONR223 100% 43.8% 35% None (many diffs) n/a
3 ccsbBroad304_12327 pLX_304 0% 43.8% 35% V5 (many diffs) n/a
4 TRCN0000472449 TTCAGGAAAATAACCCAACGTCCT pLX_317 100% 43.8% 35% V5 (many diffs) n/a
Download CSV