Transcript: Mouse XM_006522857.3

PREDICTED: Mus musculus zinc finger and BTB domain containing 21 (Zbtb21), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zbtb21 (114565)
Length:
7646
CDS:
276..3560

Additional Resources:

NCBI RefSeq record:
XM_006522857.3
NBCI Gene record:
Zbtb21 (114565)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006522857.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081621 GCCATGTTAACATGTACCATA pLKO.1 2056 CDS 100% 4.950 6.930 N Zbtb21 n/a
2 TRCN0000081619 CCGAGCTCATAAGAACGTCTT pLKO.1 482 CDS 100% 4.050 5.670 N Zbtb21 n/a
3 TRCN0000315990 CCGAGCTCATAAGAACGTCTT pLKO_005 482 CDS 100% 4.050 5.670 N Zbtb21 n/a
4 TRCN0000081622 CCACGTATGCTACAAAGCCTT pLKO.1 3176 CDS 100% 2.640 3.696 N Zbtb21 n/a
5 TRCN0000315989 CCACGTATGCTACAAAGCCTT pLKO_005 3176 CDS 100% 2.640 3.696 N Zbtb21 n/a
6 TRCN0000019987 CGCTTGTGACATCTGTCACAA pLKO.1 2093 CDS 100% 0.495 0.396 N ZBTB21 n/a
7 TRCN0000081620 GCAAGTCATCAAGAGGAACTT pLKO.1 2333 CDS 100% 4.950 3.465 N Zbtb21 n/a
8 TRCN0000315915 GCAAGTCATCAAGAGGAACTT pLKO_005 2333 CDS 100% 4.950 3.465 N Zbtb21 n/a
9 TRCN0000081618 CCAGCTACAGAGAAGCTGTTT pLKO.1 3396 CDS 100% 0.495 0.347 N Zbtb21 n/a
10 TRCN0000316010 CCAGCTACAGAGAAGCTGTTT pLKO_005 3396 CDS 100% 0.495 0.347 N Zbtb21 n/a
11 TRCN0000180418 GATCACTTGAGCTCAGGAGTT pLKO.1 6872 3UTR 100% 4.050 2.430 N ERN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006522857.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08173 pDONR223 100% 80.4% 84% None (many diffs) n/a
2 ccsbBroad304_08173 pLX_304 0% 80.4% 84% V5 (many diffs) n/a
3 TRCN0000476213 ACATGGAGTCGCCGAATTATCACG pLX_317 10.1% 80.4% 84% V5 (many diffs) n/a
Download CSV