Transcript: Mouse XM_006522982.3

PREDICTED: Mus musculus T cell lymphoma invasion and metastasis 1 (Tiam1), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tiam1 (21844)
Length:
7123
CDS:
337..5112

Additional Resources:

NCBI RefSeq record:
XM_006522982.3
NBCI Gene record:
Tiam1 (21844)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006522982.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000329080 CATTCGATCCTGCGAGATAAA pLKO_005 4507 CDS 100% 13.200 18.480 N Tiam1 n/a
2 TRCN0000042595 CGGAATTTGGTGTCGGATATT pLKO.1 1108 CDS 100% 13.200 18.480 N Tiam1 n/a
3 TRCN0000329078 GCGAAATTGTCCACGTGAAAT pLKO_005 4403 CDS 100% 13.200 18.480 N Tiam1 n/a
4 TRCN0000042594 CCAACCATCAACCAGGTGTTT pLKO.1 2464 CDS 100% 4.950 6.930 N Tiam1 n/a
5 TRCN0000042597 GCAAGAGATTGTGTGCGCTTA pLKO.1 4592 CDS 100% 4.050 5.670 N Tiam1 n/a
6 TRCN0000042596 GCCGCTGATAATTACGGGTTT pLKO.1 2896 CDS 100% 4.050 5.670 N Tiam1 n/a
7 TRCN0000042593 CCCACAAATTAGCCTTAGCAA pLKO.1 1245 CDS 100% 3.000 4.200 N Tiam1 n/a
8 TRCN0000329017 CTCAAGCTACTGCCGGAATTT pLKO_005 1095 CDS 100% 13.200 10.560 N Tiam1 n/a
9 TRCN0000329020 CCTCTTCAGCGTCCGAGAATA pLKO_005 5597 3UTR 100% 13.200 9.240 N Tiam1 n/a
10 TRCN0000329079 CTGGGTGGACCGAGTAGATAT pLKO_005 603 CDS 100% 13.200 9.240 N Tiam1 n/a
11 TRCN0000009870 GACATCAAGGAGACAGACATC pLKO.1 4828 CDS 100% 4.050 2.835 N TIAM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006522982.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000476458 CAACCAGGCTTTAGGCAGGCCGTC pLX_317 7.4% 89.2% 95.2% V5 (many diffs) n/a
Download CSV