Transcript: Mouse XM_006523226.1

PREDICTED: Mus musculus T cell lymphoma invasion and metastasis 2 (Tiam2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tiam2 (24001)
Length:
6010
CDS:
194..5341

Additional Resources:

NCBI RefSeq record:
XM_006523226.1
NBCI Gene record:
Tiam2 (24001)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006523226.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217955 AGCATCTCAACCGGATATTTA pLKO_005 2997 CDS 100% 15.000 21.000 N Tiam2 n/a
2 TRCN0000238431 CTCCGAAAGGTGGTCGATAAA pLKO_005 2816 CDS 100% 13.200 18.480 N Tiam2 n/a
3 TRCN0000450224 GTTAAGGTGATTCGTTCTATT pLKO_005 4595 CDS 100% 13.200 18.480 N TIAM2 n/a
4 TRCN0000110006 CGGGTGTTTAAGAGTCGAGTT pLKO.1 694 CDS 100% 4.050 5.670 N Tiam2 n/a
5 TRCN0000110009 CGACAGAACATCTATGAGAAT pLKO.1 1550 CDS 100% 4.950 3.960 N Tiam2 n/a
6 TRCN0000110005 GCTTGGGAAAGTTGTGATTAA pLKO.1 5784 3UTR 100% 13.200 9.240 N Tiam2 n/a
7 TRCN0000238429 GGATCCAAGAATCATAGTAAT pLKO_005 227 CDS 100% 13.200 9.240 N Tiam2 n/a
8 TRCN0000238428 GTGTGCTTACAATGCTCATTT pLKO_005 5350 3UTR 100% 13.200 9.240 N Tiam2 n/a
9 TRCN0000238430 TCTCCGCTTCCTCGGACTTTA pLKO_005 3750 CDS 100% 13.200 9.240 N Tiam2 n/a
10 TRCN0000107211 CCACTTCAGAATGAGACCTTT pLKO.1 3638 CDS 100% 4.950 3.465 N TIAM2 n/a
11 TRCN0000110008 GCCACGAGTGATTTCAGCAAT pLKO.1 3311 CDS 100% 4.950 3.465 N Tiam2 n/a
12 TRCN0000110007 GCTAAGAAAGACACCCTCAAA pLKO.1 1298 CDS 100% 4.950 3.465 N Tiam2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006523226.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.