Transcript: Mouse XM_006523399.3

PREDICTED: Mus musculus ankyrin repeat domain 12 (Ankrd12), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ankrd12 (106585)
Length:
10763
CDS:
258..6314

Additional Resources:

NCBI RefSeq record:
XM_006523399.3
NBCI Gene record:
Ankrd12 (106585)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006523399.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254401 GATGAATACGTAACGTTTAAT pLKO_005 5718 CDS 100% 15.000 21.000 N Ankrd12 n/a
2 TRCN0000254402 TGTACTGGCATGCGCAATAAA pLKO_005 8007 3UTR 100% 15.000 21.000 N Ankrd12 n/a
3 TRCN0000216337 GATCTGACATAGATTAGATAT pLKO.1 7671 3UTR 100% 13.200 18.480 N Ankrd12 n/a
4 TRCN0000265530 TGATCTCACTCGGTATGATAA pLKO_005 1901 CDS 100% 13.200 18.480 N Ankrd12 n/a
5 TRCN0000190310 CCACGTATAAGTCTCTCAGTA pLKO.1 6223 CDS 100% 4.950 6.930 N Ankrd12 n/a
6 TRCN0000265523 GAACTACCAGACCGACTTAAA pLKO_005 3933 CDS 100% 13.200 9.240 N Ankrd12 n/a
7 TRCN0000254403 TTCGCTGTCAGATCCACTTAA pLKO_005 5804 CDS 100% 13.200 9.240 N Ankrd12 n/a
8 TRCN0000189684 GCTCGGAATCTCAGTTGTCAT pLKO.1 3841 CDS 100% 4.950 3.465 N Ankrd12 n/a
9 TRCN0000192162 CCCAAACAACAACAACAACAA pLKO.1 7239 3UTR 100% 4.950 2.475 Y Ankrd12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006523399.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11704 pDONR223 100% 13.2% 13.6% None (many diffs) n/a
2 ccsbBroad304_11704 pLX_304 0% 13.2% 13.6% V5 (many diffs) n/a
3 TRCN0000474248 CCCCCCGAGCAAGAAGATTAATGC pLX_317 48.7% 13.2% 13.6% V5 (many diffs) n/a
Download CSV