Transcript: Mouse XM_006523478.3

PREDICTED: Mus musculus suppressor of Ty 3 (Supt3), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Supt3 (109115)
Length:
1849
CDS:
596..1846

Additional Resources:

NCBI RefSeq record:
XM_006523478.3
NBCI Gene record:
Supt3 (109115)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006523478.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039267 CACTTCAAGTAGTGGAAGAAA pLKO.1 631 CDS 100% 5.625 7.875 N Supt3 n/a
2 TRCN0000039268 CGTACTATGGATTCAGCTCAA pLKO.1 1118 CDS 100% 4.050 5.670 N Supt3 n/a
3 TRCN0000039266 CGGTACAAACAAGAGACAGAA pLKO.1 979 CDS 100% 4.950 3.960 N Supt3 n/a
4 TRCN0000039264 CGACAGTTAAGTTTCTCCAAA pLKO.1 1160 CDS 100% 4.950 3.465 N Supt3 n/a
5 TRCN0000039265 GCTCTTCTAGTGAGGCAAGAT pLKO.1 1301 CDS 100% 4.950 3.465 N Supt3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006523478.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13993 pDONR223 100% 62.2% 56.4% None (many diffs) n/a
2 ccsbBroad304_13993 pLX_304 0% 62.2% 56.4% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000475333 CGGCCAAAGCTTCGAAATTAGGCC pLX_317 56.8% 62.2% 56.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV