Transcript: Mouse XM_006523498.3

PREDICTED: Mus musculus adenylate cyclase activating polypeptide 1 (Adcyap1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Adcyap1 (11516)
Length:
3399
CDS:
401..985

Additional Resources:

NCBI RefSeq record:
XM_006523498.3
NBCI Gene record:
Adcyap1 (11516)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006523498.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109818 CTGCTGGTGTATGGGATAATA pLKO.1 431 CDS 100% 15.000 21.000 N Adcyap1 n/a
2 TRCN0000109817 GCTGGTGTATGGGATAATAAT pLKO.1 433 CDS 100% 15.000 12.000 N Adcyap1 n/a
3 TRCN0000371180 ATACTTTGTGGACCAATTATT pLKO_005 1163 3UTR 100% 15.000 10.500 N ADCYAP1 n/a
4 TRCN0000109815 GCCCAGAAGGAAATTCTAATT pLKO.1 1625 3UTR 100% 13.200 9.240 N Adcyap1 n/a
5 TRCN0000109819 CGGCATCTTCACAGATAGCTA pLKO.1 856 CDS 100% 3.000 2.100 N Adcyap1 n/a
6 TRCN0000109816 GCCCACGAAATCCTTAACGAA pLKO.1 704 CDS 100% 3.000 2.100 N Adcyap1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006523498.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00025 pDONR223 100% 78.1% 74.3% None (many diffs) n/a
2 ccsbBroad304_00025 pLX_304 0% 78.1% 74.3% V5 (many diffs) n/a
3 TRCN0000479898 TTAACCAATCCCAATATTTGCCAA pLX_317 62.4% 78.1% 74.3% V5 (many diffs) n/a
4 TRCN0000488695 GTGAATATTCCGCACACTGGACCA pLX_317 62.2% 78.1% 74.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV