Transcript: Mouse XM_006523856.3

PREDICTED: Mus musculus Pbx/knotted 1 homeobox (Pknox1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pknox1 (18771)
Length:
4507
CDS:
473..1780

Additional Resources:

NCBI RefSeq record:
XM_006523856.3
NBCI Gene record:
Pknox1 (18771)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006523856.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000311010 AGTGGTCACGCAGGCATTATC pLKO_005 1138 CDS 100% 13.200 18.480 N Pknox1 n/a
2 TRCN0000229667 TTTATAGGCATCCACTATTTC pLKO_005 645 CDS 100% 13.200 18.480 N PKNOX1 n/a
3 TRCN0000070699 GCCATTTATAGGCATCCACTA pLKO.1 641 CDS 100% 4.050 5.670 N Pknox1 n/a
4 TRCN0000304531 TCCGGAAACTGACAACCTAAT pLKO_005 805 CDS 100% 10.800 8.640 N Pknox1 n/a
5 TRCN0000070700 CCCTACAACAGGGAAATGTAA pLKO.1 1053 CDS 100% 5.625 4.500 N Pknox1 n/a
6 TRCN0000301805 CCCTACAACAGGGAAATGTAA pLKO_005 1053 CDS 100% 5.625 4.500 N Pknox1 n/a
7 TRCN0000020528 CCATTTATAGGCATCCACTAT pLKO.1 642 CDS 100% 4.950 3.960 N PKNOX1 n/a
8 TRCN0000304529 TTGAACTGGAGAAGGTTAATG pLKO_005 861 CDS 100% 13.200 9.240 N Pknox1 n/a
9 TRCN0000304530 TTGAGTCCTTGACGAGATTAA pLKO_005 1998 3UTR 100% 13.200 9.240 N Pknox1 n/a
10 TRCN0000070698 GCTATCAAGATGGACAGCAAA pLKO.1 504 CDS 100% 4.950 3.465 N Pknox1 n/a
11 TRCN0000070702 GAGAACTTTGTCAGGAAGCAA pLKO.1 752 CDS 100% 3.000 2.100 N Pknox1 n/a
12 TRCN0000070701 GCTTCAAGTCAACAACTGGTT pLKO.1 1378 CDS 100% 2.640 1.848 N Pknox1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006523856.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06732 pDONR223 100% 87.3% 95.8% None (many diffs) n/a
2 ccsbBroad304_06732 pLX_304 0% 87.3% 95.8% V5 (many diffs) n/a
3 TRCN0000480720 ATTCTGAGATCGGGAAGACTGACA pLX_317 30.7% 87.3% 95.8% V5 (many diffs) n/a
Download CSV