Transcript: Mouse XM_006523861.3

PREDICTED: Mus musculus protein phosphatase 1B, magnesium dependent, beta isoform (Ppm1b), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ppm1b (19043)
Length:
1901
CDS:
423..1604

Additional Resources:

NCBI RefSeq record:
XM_006523861.3
NBCI Gene record:
Ppm1b (19043)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006523861.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081122 CAGGATCACAAACCTTGTAAT pLKO.1 921 CDS 100% 13.200 10.560 N Ppm1b n/a
2 TRCN0000081015 CGAGATAACATGAGTGTTGTA pLKO.1 1275 CDS 100% 4.950 3.960 N LOC433336 n/a
3 TRCN0000081119 CCATGTTATTGAAGCTGTTTA pLKO.1 1502 CDS 100% 13.200 9.240 N Ppm1b n/a
4 TRCN0000081121 GCAAGGATGGAGAGTAGAAAT pLKO.1 509 CDS 100% 13.200 9.240 N Ppm1b n/a
5 TRCN0000081120 CCAGGATCACAAACCTTGTAA pLKO.1 920 CDS 100% 5.625 3.938 N Ppm1b n/a
6 TRCN0000081014 GCCATGTTATTGAAGCTGTTT pLKO.1 1501 CDS 100% 4.950 3.465 N LOC433336 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006523861.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01255 pDONR223 100% 19.1% 17.5% None (many diffs) n/a
2 ccsbBroad304_01255 pLX_304 0% 19.1% 17.5% V5 (many diffs) n/a
3 TRCN0000479066 GCCTTGTTTCACATTTAGACTTAT pLX_317 66.4% 19.1% 17.5% V5 (many diffs) n/a
Download CSV