Transcript: Mouse XM_006524095.3

PREDICTED: Mus musculus BTB (POZ) domain containing 9 (Btbd9), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Btbd9 (224671)
Length:
9211
CDS:
781..1968

Additional Resources:

NCBI RefSeq record:
XM_006524095.3
NBCI Gene record:
Btbd9 (224671)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006524095.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217223 CACGATGCTCCTCAGATATAT pLKO.1 1044 CDS 100% 15.000 10.500 N Btbd9 n/a
2 TRCN0000241736 CTTGGCCAGCCGTCCATTATA pLKO_005 1756 CDS 100% 15.000 10.500 N Btbd9 n/a
3 TRCN0000244337 ACCGTGACAGCCGGTCTTATT pLKO_005 1802 CDS 100% 13.200 9.240 N Btbd9 n/a
4 TRCN0000245405 CACTCCTGAATATCGTCTTAA pLKO_005 1334 CDS 100% 13.200 9.240 N Btbd9 n/a
5 TRCN0000194231 GCACTCCTGAATATCGTCTTA pLKO.1 1333 CDS 100% 4.950 3.465 N Btbd9 n/a
6 TRCN0000106535 GCCTGGTCTACAAAGTGAGTT pLKO.1 6194 3UTR 100% 4.950 2.475 Y Gad2 n/a
7 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 6135 3UTR 100% 4.050 2.025 Y Mtif2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006524095.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04659 pDONR223 100% 45.6% 49.7% None (many diffs) n/a
2 ccsbBroad304_04659 pLX_304 0% 45.6% 49.7% V5 (many diffs) n/a
3 TRCN0000466788 CTTGAGATGGGCCAGTAACTGTGC pLX_317 21.5% 45.6% 49.7% V5 (many diffs) n/a
Download CSV