Transcript: Mouse XM_006524320.3

PREDICTED: Mus musculus glutamate receptor, metabotropic 4 (Grm4), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Grm4 (268934)
Length:
2967
CDS:
273..2087

Additional Resources:

NCBI RefSeq record:
XM_006524320.3
NBCI Gene record:
Grm4 (268934)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006524320.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104897 GTACATCAGAAACGTCAACTT pLKO.1 692 CDS 100% 4.950 6.930 N Grm4 n/a
2 TRCN0000104899 GCCCATACCCATTGTCAAGTT pLKO.1 1070 CDS 100% 4.950 3.465 N Grm4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006524320.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00694 pDONR223 100% 60.1% 64.6% None (many diffs) n/a
2 ccsbBroad304_00694 pLX_304 0% 60.1% 64.6% V5 (many diffs) n/a
3 TRCN0000469136 TGTCAGTACCAAATCGTACCCGTT pLX_317 16.6% 60.1% 64.6% V5 (many diffs) n/a
4 ccsbBroadEn_15435 pDONR223 0% 60.1% 64.6% None (many diffs) n/a
5 ccsbBroad304_15435 pLX_304 0% 60.1% 64.6% V5 (many diffs) n/a
6 TRCN0000473211 TAGCCGACCTATAATCGACGCAGA pLX_317 17.3% 60.1% 64.6% V5 (many diffs) n/a
7 TRCN0000488196 GAAGCCAATACTTTCTTAAATTAT pLX_317 10.8% 60.1% 64.6% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000489621 TGTCGATCGCGCACCGGAACAAAA pLX_317 12.5% 60.1% 64.6% V5 (many diffs) n/a
Download CSV