Transcript: Mouse XM_006524433.3

PREDICTED: Mus musculus lipoma HMGIC fusion partner-like 5 (Lhfpl5), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lhfpl5 (328789)
Length:
2319
CDS:
633..1382

Additional Resources:

NCBI RefSeq record:
XM_006524433.3
NBCI Gene record:
Lhfpl5 (328789)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006524433.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000189933 GTCTAGTCTACCCAGATGGTT pLKO.1 1066 CDS 100% 3.000 4.200 N Lhfpl5 n/a
2 TRCN0000131070 CCTTCAAGACTGCCATGTTCT pLKO.1 910 CDS 100% 4.950 3.465 N LHFPL5 n/a
3 TRCN0000189878 CTGTAATACAGCCACGGTCTA pLKO.1 992 CDS 100% 4.050 2.835 N Lhfpl5 n/a
4 TRCN0000127894 CTTCAAGACTGCCATGTTCTT pLKO.1 911 CDS 100% 4.950 2.970 N LHFPL5 n/a
5 TRCN0000131065 CATCATCTGCTTCAGCCTGTT pLKO.1 965 CDS 100% 4.050 2.430 N LHFPL5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006524433.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09884 pDONR223 100% 77.5% 85.1% None (many diffs) n/a
2 ccsbBroad304_09884 pLX_304 0% 77.5% 85.1% V5 (many diffs) n/a
3 TRCN0000465705 CTCAGGCAAGTTTACGCTTGATTT pLX_317 50.3% 77.5% 85.1% V5 (many diffs) n/a
Download CSV