Transcript: Mouse XM_006524601.3

PREDICTED: Mus musculus cysteine rich transmembrane BMP regulator 1 (chordin like) (Crim1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Crim1 (50766)
Length:
5768
CDS:
538..3408

Additional Resources:

NCBI RefSeq record:
XM_006524601.3
NBCI Gene record:
Crim1 (50766)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006524601.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251702 AGGAGAAGGACTGCGTTTATG pLKO_005 1727 CDS 100% 13.200 18.480 N Crim1 n/a
2 TRCN0000265203 GTGCGTGGATAGCGCAATTAG pLKO_005 2622 CDS 100% 13.200 18.480 N Crim1 n/a
3 TRCN0000173204 CCATCATCATAAGAACGAGGA pLKO.1 2133 CDS 100% 2.160 3.024 N Crim1 n/a
4 TRCN0000251699 GGTAGATTACAGAGATAATAA pLKO_005 3057 CDS 100% 15.000 12.000 N Crim1 n/a
5 TRCN0000176346 CAAGCCTTCTTCCTTGAATAA pLKO.1 3228 CDS 100% 13.200 9.240 N Crim1 n/a
6 TRCN0000175393 CCAGGTAGATTACAGAGATAA pLKO.1 3054 CDS 100% 13.200 9.240 N Crim1 n/a
7 TRCN0000251700 TAATATGCCTGTCCATCATAA pLKO_005 3140 CDS 100% 13.200 9.240 N Crim1 n/a
8 TRCN0000251701 TCATCTCCGGCTGCAACATAA pLKO_005 923 CDS 100% 13.200 9.240 N Crim1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006524601.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14144 pDONR223 100% 80.4% 29% None (many diffs) n/a
2 ccsbBroad304_14144 pLX_304 0% 80.4% 29% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000480541 ACATAGGCCCAGCACTACTATAAC pLX_317 13.5% 80.4% 29% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV