Transcript: Mouse XM_006524671.3

PREDICTED: Mus musculus suppressor of cytokine signaling 5 (Socs5), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Socs5 (56468)
Length:
4496
CDS:
483..2093

Additional Resources:

NCBI RefSeq record:
XM_006524671.3
NBCI Gene record:
Socs5 (56468)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006524671.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105753 GCACAGGTCAACCCATTGTAT pLKO.1 1353 CDS 100% 5.625 7.875 N Socs5 n/a
2 TRCN0000316680 GCACAGGTCAACCCATTGTAT pLKO_005 1353 CDS 100% 5.625 7.875 N Socs5 n/a
3 TRCN0000381747 ACTTACAGCAAGCAGTCAAAG pLKO_005 1059 CDS 100% 10.800 8.640 N SOCS5 n/a
4 TRCN0000105750 CCGTGCTAATAAAGTATGTTT pLKO.1 3445 3UTR 100% 5.625 4.500 N Socs5 n/a
5 TRCN0000305117 AGAATGGGAGCTTAGTCATTA pLKO_005 2186 3UTR 100% 13.200 9.240 N Socs5 n/a
6 TRCN0000305116 TGAACCGTTGCTAACGATATC pLKO_005 1886 CDS 100% 10.800 7.560 N Socs5 n/a
7 TRCN0000105751 GCACAAATACACACCTTTGAA pLKO.1 1326 CDS 100% 5.625 3.938 N Socs5 n/a
8 TRCN0000349191 GCACAAATACACACCTTTGAA pLKO_005 1326 CDS 100% 5.625 3.938 N Socs5 n/a
9 TRCN0000105752 CCGTAATGAGAACGTGGAGAT pLKO.1 557 CDS 100% 4.050 2.835 N Socs5 n/a
10 TRCN0000105754 GAAGAGGATTCAACCACCCTA pLKO.1 1455 CDS 100% 2.640 1.848 N Socs5 n/a
11 TRCN0000316745 GAAGAGGATTCAACCACCCTA pLKO_005 1455 CDS 100% 2.640 1.848 N Socs5 n/a
12 TRCN0000220159 TCCCATGAGAACTTACAGCAA pLKO.1 1049 CDS 100% 2.640 1.848 N SOCS5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006524671.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07459 pDONR223 99.8% 87.4% 94.2% None (many diffs) n/a
2 ccsbBroad304_07459 pLX_304 0% 87.4% 94.2% V5 (many diffs) n/a
3 TRCN0000491460 AATACCCGAACTCTTTGTCATTGA pLX_317 1% 87% 93.8% V5 (many diffs) n/a
Download CSV