Transcript: Mouse XM_006524765.3

PREDICTED: Mus musculus TATA-box binding protein associated factor 8 (Taf8), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Taf8 (63856)
Length:
1198
CDS:
53..970

Additional Resources:

NCBI RefSeq record:
XM_006524765.3
NBCI Gene record:
Taf8 (63856)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006524765.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348091 CGAGGAGAGCGTCATCGATAA pLKO_005 901 CDS 100% 10.800 15.120 N Taf8 n/a
2 TRCN0000084350 CGTGGTCACATTGGTTGAAAT pLKO.1 325 CDS 100% 13.200 10.560 N Taf8 n/a
3 TRCN0000348089 AGAGAACAACGCTCTTCATAT pLKO_005 799 CDS 100% 13.200 9.240 N Taf8 n/a
4 TRCN0000348153 TTGCTGACAGAGGCGGGATTT pLKO_005 176 CDS 100% 10.800 7.560 N Taf8 n/a
5 TRCN0000084352 GATACAGAGAACAACGCTCTT pLKO.1 794 CDS 100% 4.050 2.835 N Taf8 n/a
6 TRCN0000084351 CTGGAGATACAGCAGATGGAA pLKO.1 740 CDS 100% 3.000 2.100 N Taf8 n/a
7 TRCN0000084349 GCAGAGCTACATCTCAGAAAT pLKO.1 241 CDS 100% 13.200 7.920 N Taf8 n/a
8 TRCN0000333930 GCAGAGCTACATCTCAGAAAT pLKO_005 241 CDS 100% 13.200 7.920 N Taf8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006524765.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13147 pDONR223 100% 88.2% 93.2% None (many diffs) n/a
2 ccsbBroad304_13147 pLX_304 0% 88.2% 93.2% V5 (many diffs) n/a
3 TRCN0000467148 TTCCATGCTATTCTTCTTCCACAT pLX_317 16.2% 88.2% 93.2% V5 (many diffs) n/a
4 ccsbBroadEn_13146 pDONR223 100% 51.3% 51.7% None (many diffs) n/a
5 ccsbBroad304_13146 pLX_304 0% 51.3% 51.7% V5 (many diffs) n/a
6 TRCN0000473773 CGGGTATGAAGAAAAACTTAAGCG pLX_317 87.2% 51.3% 51.7% V5 (many diffs) n/a
Download CSV