Transcript: Mouse XM_006526040.3

PREDICTED: Mus musculus zinc finger protein 532 (Zfp532), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp532 (328977)
Length:
6012
CDS:
613..4527

Additional Resources:

NCBI RefSeq record:
XM_006526040.3
NBCI Gene record:
Zfp532 (328977)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526040.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230136 CGGTGAAAGCCACGGTCATAT pLKO_005 2033 CDS 100% 13.200 18.480 N ZNF532 n/a
2 TRCN0000242174 CGGTGAAAGCCACGGTCATAT pLKO_005 2033 CDS 100% 13.200 18.480 N Zfp532 n/a
3 TRCN0000175034 GCAAATAAAGCAGGCAATAAT pLKO.1 2256 CDS 100% 15.000 12.000 N Zfp532 n/a
4 TRCN0000242176 ACATCAGGCCACACGGATAAA pLKO_005 1183 CDS 100% 13.200 10.560 N Zfp532 n/a
5 TRCN0000230138 GCCTCCAAACTTGGGTATAAA pLKO_005 3504 CDS 100% 15.000 10.500 N ZNF532 n/a
6 TRCN0000242175 AGCATTTGACATACCAGATAT pLKO_005 660 CDS 100% 13.200 9.240 N Zfp532 n/a
7 TRCN0000216136 CTTCAAGGGTATCAAGTATAT pLKO.1 5446 3UTR 100% 13.200 9.240 N Zfp532 n/a
8 TRCN0000242177 GATCAAGGACCCTGATGTAAA pLKO_005 3939 CDS 100% 13.200 9.240 N Zfp532 n/a
9 TRCN0000217429 GCCAAATGTTCTGGTACTTAA pLKO.1 5552 3UTR 100% 13.200 9.240 N Zfp532 n/a
10 TRCN0000242173 GCCAAATGTTCTGGTACTTAA pLKO_005 5552 3UTR 100% 13.200 9.240 N Zfp532 n/a
11 TRCN0000151101 GCAACTTATGATGGACCATAT pLKO.1 3447 CDS 100% 10.800 7.560 N ZNF532 n/a
12 TRCN0000194625 GCATCAGACAGGAAGTGCAAA pLKO.1 4402 CDS 100% 4.950 3.465 N Zfp532 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526040.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14189 pDONR223 100% 73.9% 75.6% None (many diffs) n/a
2 ccsbBroad304_14189 pLX_304 0% 73.9% 75.6% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000476591 TGGGGGAACTCGCTGTCTTTAGGC pLX_317 9.1% 73.9% 75.6% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000479609 CGTCGCCAGGTAAAATCCAATCGC pLX_317 8.6% 73.9% 75.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV