Transcript: Mouse XM_006526150.1

PREDICTED: Mus musculus SEC11 homolog C, signal peptidase complex subunit (Sec11c), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sec11c (66286)
Length:
825
CDS:
214..678

Additional Resources:

NCBI RefSeq record:
XM_006526150.1
NBCI Gene record:
Sec11c (66286)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526150.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222494 GACATCAAGTTTCTGACTAAA pLKO.1 457 CDS 100% 13.200 10.560 N Sec11c n/a
2 TRCN0000348878 TCTGCTGTTCCTCACGAATTT pLKO_005 330 CDS 100% 13.200 10.560 N Sec11c n/a
3 TRCN0000222493 CGAGGGTTCTTACCTTATGTT pLKO.1 562 CDS 100% 5.625 4.500 N Sec11c n/a
4 TRCN0000351974 CGAGGGTTCTTACCTTATGTT pLKO_005 562 CDS 100% 5.625 4.500 N Sec11c n/a
5 TRCN0000222497 CACAGAGTAATCAAGGTTCAT pLKO.1 421 CDS 100% 4.950 3.465 N Sec11c n/a
6 TRCN0000351973 CACAGAGTAATCAAGGTTCAT pLKO_005 421 CDS 100% 4.950 3.465 N Sec11c n/a
7 TRCN0000222495 GATCTGCTGTTCCTCACGAAT pLKO.1 328 CDS 100% 4.950 3.465 N Sec11c n/a
8 TRCN0000046758 GAGAAGCAGTTCCTGGGACCA pLKO.1 682 3UTR 100% 0.720 0.504 N SEC11C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526150.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04527 pDONR223 100% 74.6% 80.2% None (many diffs) n/a
2 ccsbBroad304_04527 pLX_304 0% 74.6% 80.2% V5 (many diffs) n/a
3 TRCN0000473398 TTAAAAGTCTATCAGTCGCAGGCA pLX_317 32% 74.6% 80.2% V5 (many diffs) n/a
Download CSV