Transcript: Mouse XM_006526189.3

PREDICTED: Mus musculus dynactin 4 (Dctn4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dctn4 (67665)
Length:
3796
CDS:
73..1476

Additional Resources:

NCBI RefSeq record:
XM_006526189.3
NBCI Gene record:
Dctn4 (67665)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526189.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295652 TGCTTCACCAGTCGTGTTTAT pLKO_005 1532 3UTR 100% 13.200 18.480 N Dctn4 n/a
2 TRCN0000090127 CAACGGATGAACAAGTTGATT pLKO.1 496 CDS 100% 5.625 7.875 N Dctn4 n/a
3 TRCN0000288320 CAACGGATGAACAAGTTGATT pLKO_005 496 CDS 100% 5.625 7.875 N Dctn4 n/a
4 TRCN0000090124 GCGAAGAAATTACATGCCTTT pLKO.1 579 CDS 100% 4.050 5.670 N Dctn4 n/a
5 TRCN0000288319 GCGAAGAAATTACATGCCTTT pLKO_005 579 CDS 100% 4.050 5.670 N Dctn4 n/a
6 TRCN0000008666 GCTGTCAATTATATTCCAGAA pLKO.1 997 CDS 100% 4.050 5.670 N DCTN4 n/a
7 TRCN0000295651 GTTGGTTGCTGTCAATTATAT pLKO_005 990 CDS 100% 15.000 12.000 N Dctn4 n/a
8 TRCN0000090125 CCTCCCAAAGAGCTCATCTTA pLKO.1 1174 CDS 100% 5.625 3.938 N Dctn4 n/a
9 TRCN0000090123 CCTGCTTACAAACCCTGCTTT pLKO.1 2733 3UTR 100% 4.950 3.465 N Dctn4 n/a
10 TRCN0000090126 GCTTCAAGATGAAACACGATT pLKO.1 1346 CDS 100% 4.950 3.465 N Dctn4 n/a
11 TRCN0000288389 GCTTCAAGATGAAACACGATT pLKO_005 1346 CDS 100% 4.950 3.465 N Dctn4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526189.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000475226 CCGGACCACAACGTAAAGCATTTA pLX_317 29.6% 88% 94.8% V5 (many diffs) n/a
2 ccsbBroadEn_08238 pDONR223 100% 88% 94.6% None (many diffs) n/a
3 ccsbBroad304_08238 pLX_304 0% 88% 94.6% V5 (many diffs) n/a
Download CSV