Transcript: Mouse XM_006526212.2

PREDICTED: Mus musculus DTW domain containing 2 (Dtwd2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dtwd2 (68857)
Length:
3288
CDS:
102..1772

Additional Resources:

NCBI RefSeq record:
XM_006526212.2
NBCI Gene record:
Dtwd2 (68857)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526212.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251340 GAACTTGGCTGGTCCTAATTA pLKO_005 3031 3UTR 100% 15.000 21.000 N Dtwd2 n/a
2 TRCN0000251339 TGCCGGGACTCTGGTACATTA pLKO_005 1302 CDS 100% 13.200 18.480 N Dtwd2 n/a
3 TRCN0000251342 CTAGCGTTTGTAGTCAGTATG pLKO_005 1486 CDS 100% 10.800 15.120 N Dtwd2 n/a
4 TRCN0000251341 ATTCGCCTCAGCAAGGAATAT pLKO_005 1659 CDS 100% 13.200 9.240 N Dtwd2 n/a
5 TRCN0000244595 TCTACCCACTTGTACATAATT pLKO_005 1149 CDS 100% 15.000 21.000 N DTWD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526212.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05403 pDONR223 100% 46% 37.4% None (many diffs) n/a
2 ccsbBroad304_05403 pLX_304 0% 46% 37.4% V5 (many diffs) n/a
3 TRCN0000469764 CCTAGGCTACGAGTTAGAATACTG pLX_317 46.4% 46% 37.4% V5 (many diffs) n/a
Download CSV