Transcript: Mouse XM_006526216.3

PREDICTED: Mus musculus dymeclin (Dym), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dym (69190)
Length:
2360
CDS:
337..2163

Additional Resources:

NCBI RefSeq record:
XM_006526216.3
NBCI Gene record:
Dym (69190)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526216.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219621 ATGTCTATATGGCCCTTATAA pLKO.1 1514 CDS 100% 15.000 21.000 N Dym n/a
2 TRCN0000193324 CCATTTCAGTTTGCAAGTCTT pLKO.1 506 CDS 100% 4.950 6.930 N Dym n/a
3 TRCN0000193180 CATTTCAGTTTGCAAGTCTTT pLKO.1 507 CDS 100% 4.950 3.960 N Dym n/a
4 TRCN0000173622 GCCTCCTAATTCTGGTGGTAA pLKO.1 1646 CDS 100% 4.950 3.960 N Dym n/a
5 TRCN0000173391 GCAGACACACAATGCTCTGTT pLKO.1 639 CDS 100% 4.950 3.465 N Dym n/a
6 TRCN0000193818 CATCAGTCACAAGTACCTGAT pLKO.1 924 CDS 100% 0.405 0.243 N Dym n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526216.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08410 pDONR223 100% 77.9% 85.6% None (many diffs) n/a
2 ccsbBroad304_08410 pLX_304 0% 77.9% 85.6% V5 (many diffs) n/a
3 TRCN0000475275 GAATCTTAACCAGAACTAATTATC pLX_317 23% 77.9% 85.6% V5 (many diffs) n/a
Download CSV