Transcript: Mouse XM_006526337.3

PREDICTED: Mus musculus janus kinase and microtubule interacting protein 2 (Jakmip2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Jakmip2 (76217)
Length:
8645
CDS:
471..2966

Additional Resources:

NCBI RefSeq record:
XM_006526337.3
NBCI Gene record:
Jakmip2 (76217)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526337.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000347423 GGGAATCCGAACGGGATATAC pLKO_005 1069 CDS 100% 13.200 18.480 N Jakmip2 n/a
2 TRCN0000347419 GCCAAGACTATGTGCTTTAAA pLKO_005 2997 3UTR 100% 15.000 10.500 N Jakmip2 n/a
3 TRCN0000347350 GGCTCTTGACCAGGCATATAT pLKO_005 2591 CDS 100% 15.000 10.500 N Jakmip2 n/a
4 TRCN0000347420 AGAATCTGAGCTACGATTTAG pLKO_005 1886 CDS 100% 13.200 9.240 N Jakmip2 n/a
5 TRCN0000347421 GTCCTGGTGACCGAGCTTAAA pLKO_005 672 CDS 100% 13.200 9.240 N Jakmip2 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6774 3UTR 100% 4.950 2.475 Y KAAG1 n/a
7 TRCN0000165205 GCCTCAGTTTCCTCATCTGTA pLKO.1 4496 3UTR 100% 4.950 2.475 Y YIF1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526337.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02255 pDONR223 100% 87.9% 96.2% None (many diffs) n/a
2 ccsbBroad304_02255 pLX_304 0% 87.9% 96.2% V5 (many diffs) n/a
3 TRCN0000481259 TGGACTTACAACCAGCCCTACCCT pLX_317 17.5% 87.9% 96.2% V5 (many diffs) n/a
Download CSV