Transcript: Mouse XM_006526539.3

PREDICTED: Mus musculus PDZ domain containing 7 (Pdzd7), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pdzd7 (100503041)
Length:
2514
CDS:
391..2424

Additional Resources:

NCBI RefSeq record:
XM_006526539.3
NBCI Gene record:
Pdzd7 (100503041)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526539.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140413 GACGCTGATGAACCTCTTCTT pLKO.1 1785 CDS 100% 4.950 3.465 N PDZD7 n/a
2 TRCN0000141876 GCTGATGAACCTCTTCTTCAA pLKO.1 1788 CDS 100% 4.950 3.465 N PDZD7 n/a
3 TRCN0000139457 CAAGACGCTGATGAACCTCTT pLKO.1 1782 CDS 100% 4.050 2.835 N PDZD7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526539.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14276 pDONR223 100% 65.1% 69.1% None (many diffs) n/a
2 ccsbBroad304_14276 pLX_304 0% 65.1% 69.1% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000479509 CTTACGGTTTCCACAAAGGTCACC pLX_317 17.6% 65.1% 69.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV