Transcript: Mouse XM_006526562.2

PREDICTED: Mus musculus MACRO domain containing 1 (Macrod1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Macrod1 (107227)
Length:
1280
CDS:
164..1168

Additional Resources:

NCBI RefSeq record:
XM_006526562.2
NBCI Gene record:
Macrod1 (107227)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526562.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000328664 ACTTCTGCAAGGATTTCATTA pLKO_005 498 CDS 100% 13.200 9.240 N Macrod1 n/a
2 TRCN0000328735 TATCGGCTGCCAGCCAAGTAT pLKO_005 803 CDS 100% 5.625 3.938 N Macrod1 n/a
3 TRCN0000183316 GACAAGCAACTGAATGAGAAA pLKO.1 596 CDS 100% 4.950 3.465 N Macrod1 n/a
4 TRCN0000328662 GACAAGCAACTGAATGAGAAA pLKO_005 596 CDS 100% 4.950 3.465 N Macrod1 n/a
5 TRCN0000328734 TGCATCTCCACAGGCGTGTTT pLKO_005 953 CDS 100% 4.950 3.465 N Macrod1 n/a
6 TRCN0000183241 GAACATTACTTCTGCAAGGAT pLKO.1 491 CDS 100% 3.000 2.100 N Macrod1 n/a
7 TRCN0000184809 CAAATCCTTTCTGAAGGGCCT pLKO.1 451 CDS 100% 0.540 0.378 N Macrod1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526562.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11892 pDONR223 100% 63.6% 66.1% None (many diffs) n/a
2 ccsbBroad304_11892 pLX_304 0% 63.6% 66.1% V5 (many diffs) n/a
3 TRCN0000467878 CTGCCTACTGGTCGGCAGCCTAAC pLX_317 60.6% 63.6% 66.1% V5 (many diffs) n/a
Download CSV