Transcript: Mouse XM_006526699.3

PREDICTED: Mus musculus helicase, lymphoid specific (Hells), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hells (15201)
Length:
5255
CDS:
147..2612

Additional Resources:

NCBI RefSeq record:
XM_006526699.3
NBCI Gene record:
Hells (15201)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526699.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304503 TTACATCCATTCTGGTAATTT pLKO_005 2645 3UTR 100% 15.000 21.000 N Hells n/a
2 TRCN0000039044 CCGGCTAATCAGGGAGTTAAA pLKO.1 1187 CDS 100% 13.200 18.480 N Hells n/a
3 TRCN0000301773 CCGGCTAATCAGGGAGTTAAA pLKO_005 1187 CDS 100% 13.200 18.480 N Hells n/a
4 TRCN0000304507 TCGAATGCTGCCCGAACTTAA pLKO_005 1910 CDS 100% 13.200 18.480 N Hells n/a
5 TRCN0000039048 CGTCGGAAATTAGTAAAGAAT pLKO.1 1020 CDS 100% 5.625 7.875 N Hells n/a
6 TRCN0000331579 CGTCGGAAATTAGTAAAGAAT pLKO_005 1020 CDS 100% 5.625 7.875 N Hells n/a
7 TRCN0000039045 CGGAATATAATGATGCTACTT pLKO.1 1776 CDS 100% 4.950 3.960 N Hells n/a
8 TRCN0000039046 CGAGTCTTTGTGTAGAAGATA pLKO.1 592 CDS 100% 5.625 3.938 N Hells n/a
9 TRCN0000331756 CGAGTCTTTGTGTAGAAGATA pLKO_005 592 CDS 100% 5.625 3.938 N Hells n/a
10 TRCN0000039047 GCAAATACTATTGACCAGAAA pLKO.1 2268 CDS 100% 4.950 3.465 N Hells n/a
11 TRCN0000000307 GCCAGATGTATTTGATGACTT pLKO.1 1298 CDS 100% 4.950 3.465 N HELLS n/a
12 TRCN0000273143 GCCAGATGTATTTGATGACTT pLKO_005 1298 CDS 100% 4.950 3.465 N HELLS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526699.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10871 pDONR223 100% 37.9% 38.7% None (many diffs) n/a
2 ccsbBroad304_10871 pLX_304 0% 37.9% 38.7% V5 (many diffs) n/a
3 TRCN0000478779 TCTCAGACAGATCTATGCCGGTGC pLX_317 27.1% 37.9% 38.7% V5 (many diffs) n/a
Download CSV