Transcript: Mouse XM_006526759.3

PREDICTED: Mus musculus proprotein convertase subtilisin/kexin type 5 (Pcsk5), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pcsk5 (18552)
Length:
6133
CDS:
140..5692

Additional Resources:

NCBI RefSeq record:
XM_006526759.3
NBCI Gene record:
Pcsk5 (18552)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526759.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222011 GCGGGACATTTGAACGCTAAT pLKO.1 1406 CDS 100% 10.800 15.120 N Pcsk5 n/a
2 TRCN0000222013 CCTCGTTATGATGCAAGCAAT pLKO.1 749 CDS 100% 4.950 6.930 N Pcsk5 n/a
3 TRCN0000222012 CCGGAGCAGATGGATGTATTA pLKO.1 2529 CDS 100% 13.200 9.240 N Pcsk5 n/a
4 TRCN0000222014 GCCTGACTTCTTTCTATACAA pLKO.1 4168 CDS 100% 5.625 3.938 N Pcsk5 n/a
5 TRCN0000222015 GCCACTACACTTGTCAAGGAT pLKO.1 2949 CDS 100% 3.000 2.100 N Pcsk5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526759.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06697 pDONR223 100% 43.3% 44.7% None (many diffs) n/a
2 ccsbBroad304_06697 pLX_304 0% 43.3% 44.7% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000468891 TGGTCCTTATAGGCAGCTTCCTAG pLX_317 .7% 43.3% 44.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV