Transcript: Mouse XM_006526990.3

PREDICTED: Mus musculus endoplasmic reticulum metallopeptidase 1 (Ermp1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ermp1 (226090)
Length:
5490
CDS:
156..2855

Additional Resources:

NCBI RefSeq record:
XM_006526990.3
NBCI Gene record:
Ermp1 (226090)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526990.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032399 CCCACAAAGGATCAACACTTT pLKO.1 2554 CDS 100% 4.950 6.930 N Ermp1 n/a
2 TRCN0000032402 GATTCGATAAAGTTGACCTTT pLKO.1 2493 CDS 100% 4.950 3.465 N Ermp1 n/a
3 TRCN0000032403 GTTTGAGATGTTCACTCCTAT pLKO.1 1943 CDS 100% 4.950 3.465 N Ermp1 n/a
4 TRCN0000032401 CCTTGTGAACAGCACAAAGAA pLKO.1 2066 CDS 100% 0.563 0.394 N Ermp1 n/a
5 TRCN0000032400 CCAAAGCCAAAGAGAGTGTTT pLKO.1 2178 CDS 100% 4.950 2.970 N Ermp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526990.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12649 pDONR223 100% 29.9% 31.1% None (many diffs) n/a
2 ccsbBroad304_12649 pLX_304 0% 29.9% 31.1% V5 (many diffs) n/a
3 TRCN0000478996 CCCAATGCCATACTCTGATCGGCC pLX_317 41.7% 29.9% 31.1% V5 (many diffs) n/a
Download CSV